Nucleotides and Nucleic Acids

ATP

ATP contains three phosphate ions that play a significant role in energy transfer. It is essential to metabolism, which is all the chemical reactions that take place in a cell.

ATP, or Adenosine Tri Phosphate, is an immediate source of energy for biological processes. For metabolic reactions in cells to continually occur there must be a constant, steady supply of ATP.

The emphasis is on IMMEDIATE energy source. This is what is unique about ATP compared to other molecules that release energy, such as glucose, and therefore must be stated in exams to get the mark.

Below is a diagram of ATP, and this is the level of detail that you need to remember the structure in. ATP is composed of adenine, a nitrogenous base (meaning a base that contains nitrogen), ribose (a pentose sugar) and three inorganic phosphate groups. The phosphate groups are described as being inorganic because they do not contain any carbon atoms, for this reason in chemical reactions the symbol to represent this is a P for phosphate and i for inorganic -Pi

Nucleotides and Nucleic Acids, figure 1

A more detailed diagram of ATP is below.

Nucleotides and Nucleic Acids, figure 2

ATP is made during respiration. ATP is made from ADP, adenosine diphosphate, by the addition of an inorganic phosphate via a condensation reaction and using the enzyme ATP synthase. ATP can be broken down, or hydrolysed, into __ADP + Pi __by a hydrolysis reaction and the enzyme ATP hydrolase.

__ATP + H2O –> ADP + Pi __

The bonds between the inorganic phosphate groups is a high energy bond, as shown in the diagram above. Therefore, by breaking one of these bonds a small amount of energy is released to the surroundings, which can be used in chemical reactions. This is why ATP is an immediate energy source- only one bond has to be hydrolysed to release energy, and as ATP cannot be stored this occurs straight away. It is essential to remember that ATP cannot be stored.

ATP is not only able to release energy to the surroundings, it can also transfer energy to different compounds. The inorganic phosphate released during the hydrolysis of ATP can be bonded onto completely different compounds to make them more reactive. This is known as phosphorylation, and this actually happens to glucose at the start of respiration to make it more reactive.

ATP Properties

There are five key properties that ATP has making it a suitable immediate source of energy. In exam questions ATP properties are frequently compared to glucose, to emphasise why ATP is the immediate source of energy for cells rather than glucose. This is explained and demonstrated in the five points below.

1. ATP release energy in small, manageable amount so no energy is wasted.

This means that cells do not overheat from wasted heat energy and cells are less likely to run out of resources. In comparison to glucose, this would release large amounts of energy that could result in wasted energy,

2. It is small and soluble so easily transported around the cell.

ATP can move around the cytoplasm with ease to provide energy for chemical reactions within the cell. This is a property ATP has in common with glucose.

3. Only one bond is broken/hydrolysed to release energy, which is why energy release is immediate.

Glucose would need several bonds to be broken down to release all its energy.

4. It can transfer energy to another molecule by transferring one of its phosphate groups.

ATP can enable phosphorylation, making other compounds more reactive. Glucose cannot do this, as it does not contain phosphate groups.

5. ATP can’t pass out of the cell, the cell always has an immediate supply of energy.

ATP cannot leave the cell, where as glucose can. This means that all cells have a constant supply of ATP or ADP +Pi, but a cell can run out of glucose.

What is the function of ATP?
Your answer should include: Immediate / Source / Energy

RNA

RNA is a polymer of a nucleotide formed of a ribose, a nitrogenous base and a phosphate group. The nitrogenous bases in RNA are adenine, guanine, cytosine and uracil. RNA has the base uracil instead of thymine. In comparison to the DNA polymer, the RNA polymer is a relatively short polynucleotide chain and it is single stranded.

Nucleotides and Nucleic Acids, figure 1

The function of RNA is to copy and transfer the genetic code from DNA in the nucleus to the ribosomes. Some RNA is also combined with proteins to create ribosomes.

Three Types of RNA

There are three types of RNA; mRNA, tRNA and rRNA.

mRNA

Messenger RNA is a copy of a gene from DNA, the diagram below shows how mRNA is created from a DNA template. mRNA is created in the nucleus and it then leaves the nucleus to carry the copy of the genetic code of one gene to a ribosome in the cytoplasm. DNA is too large to leave the nucleus and would be at risk of being damaged by enzymes, therefore destroying the genetic code permanently. mRNA is much shorter, because it is only the length of one gene, and can therefore leave the nucleus. mRNA is short lived as it is only need temporarily to help create a protein, therefore by the time any enzymes could break it down it would have already carried out its function. mRNA is single stranded and every 3 bases in the sequence code for a specific amino acid, these three bases are therefore called codons.

Nucleotides and Nucleic Acids, figure 2

Nucleotides and Nucleic Acids, figure 3

Polynucleotides

The polymer of these nucleotides is called a polynucleotide. It is created via condensation reactions between the deoxyribose sugar and the phosphate group, creating a phosphodiester bond. Phosphodiester bonds are strong covalent bonds, and therefore help ensure that the genetic code is not broken down.

Nucleotides and Nucleic Acids, figure 1

The polynucleotide has a sugar-phosphate ‘backbone’. This is describing the strong covalent bonds between the sugar and phosphate groups that hold the polymer together.

The DNA polymer occurs in pairs, and these pairs are joined together by hydrogen bonds between the bases. This is how the double helix structure is created, as two chains twist.

Nucleotides and Nucleic Acids, figure 2

Hydrogen bonds can only form between complementary base pairs. This is the term given to the fact that the base cytosine can only form hydrogen bonds with guanine and that adenine can only bond with thymine. Adenine and thymine form 2 hydrogen bonds, whereas cytosine and guanine can form 3 hydrogen bonds. This complementary base pairing is important to help maintain the order of the genetic code when DNA replicates.

Nucleotides and Nucleic Acids, figure 3

How DNA Structure Relates to its Function

  1. Stable structure due to sugar-phosphate backbone (covalent bonds) and the double helix
  2. Double stranded so replication can occur using one strand as a template
  3. Weak hydrogen bonds for easy unzipping of the two strands in a double helix during replication.
  4. Large molecule that carries LOTS of information
  5. Complementary base pairing allows identical copies to be made.
What are the monomer units called in DNA?
Nucleotide
Name the 3 parts of this monomer unit?
Your answer should include: Phosphate / Deoxyribose / Nitrogenous / Base
If the base sequence on 1 strand of DNA is GTTACCGTA what would the sequence be on the other strand?
CAATGGCAT
If 19.9% of the base pairs in DNA are Guanine, what percentage is Thymine?
Your answer should include: 30.1% / 30.1

Three Types of RNA

Transfer RNA is found only in the cytoplasm. It is single stranded, but folded to create a shape that looks like a cloverleaf. This cloverleaf shape is held in place by hydrogen bonds, demonstrated with the dashed lines in the diagram below. The function of tRNA is to attach to one of the 20 amino acids and transfer this amino acid to the ribosome to create the polypeptide chain. Specific amino acids attach to specific tRNA molecules and this is determined by 3 bases found on the tRNA which are complementary to the 3 bases on mRNA. These are called the anticodon, because they are complementary to the codon on mRNA.

Nucleotides and Nucleic Acids, figure 1

Nucleotides and Nucleic Acids, figure 2

rRNA

Ribosomal RNA is the type of RNA that makes up the bulk of ribosomes.

Differences Between the DNA and RNA Monomers

DNA contains the base thymine, whereas RNA contains uracil instead.

DNA contains the pentose sugar deoxyribose, whereas RNA contains the pentose sugar ribose.

Differences Between the Polymers

DNA is much larger because it contains approximately 23,000 genes (the entire genome), whereas RNA is much shorter because it is only the length of one gene.

DNA is double stranded, whereas RNA is single stranded.

RNA is made from a DNA template. Write down the RNA sequence that would be made from this sequence of DNA: CCGTAGTAC
GGCAUCAUG
Name the pentose sugar found in RNA.
Ribose
Name the base the uracil substitutes in RNA.
Thymine

DNA

Deoxyribonucleic Acid (DNA) codes for the sequence of amino acids in the primary structure of a protein, which in turn determines the final 3D structure and function of a protein. It is essential therefore that cells contain a copy of this genetic code and that it can be passed on to new cells without being damaged.

Nucleotides and Nucleic Acids, figure 1

The DNA polymer is a double helix, and in this lesson details about the monomers will be covered too.

The monomer that makes up DNA is called a nucleotide. It is made up of deoxyribose (a pentose sugar), a nitrogenous base and one phosphate group.

Nucleotides and Nucleic Acids, figure 2

The nitrogenous base can either be guanine, cytosine, adenine and thymine.

Nucleotides and Nucleic Acids, figure 3

These bases are classed as either purines or pyrimidines depending on whether the base is a single or double ring structure.

Adenine and guanine are both double ring and are therefore purines.

Thymine and cytosine and both single ring structures and are therefore pyrimidines.

DNA Replication

In order for new cells to be created all the DNA in a cell must be replicated first, to ensure that when the cell splits in half each new cell still contains the full amount of DNA. This occurs in S-phase in interphase of the cell cycle.

Nucleotides and Nucleic Acids, figure 1

When describing the DNA double helix, the top and bottom of each strand is described as either the 3’ (prime) end or the 5’ (prime) end. This number refers to which carbon within the deoxyribose sugar of the nucleotide is closest to the top/bottom – see diagram below. This is relevant, as an enzyme that catalyses DNA replication is complementary in shape to the 3’ end, and can therefore only attach to the DNA at this location.

Nucleotides and Nucleic Acids, figure 2

Stages of DNA Replication

Before the DNA can be copied the double helix must first unwind. The enzyme DNA helicase breaks the hydrogen bonds between the complementary bases of the two DNA polymers within the double helix. This causes the double helix to unwind and the two strands to separate, or unzip. These two separated strands both act as templates for DNA replication. The point at which the unzipping stops is called the replication fork. Not all the DNA is unzipped in one go as this increases the chances of copying errors resulting in mutations.

Within the nucleus there are free floating DNA nucleotides. If a free floating DNA nucleotide aligns next to a complementary base on either template strand of DNA then hydrogen bonds will form between them. The enzyme DNA polymerase is responsible for then forming the phosphodiester bond between these nucleotides to create a new polymer chain of DNA.

DNA polymerase can only attach at the 3’ end, and therefore will move along the template strand in the 3’ to 5’ direction. When the enzyme is moving towards the replication fork, the new strand is referred to as the ‘leading strand’ and can be created in one continuous go. On the antiparallel strand, the DNA polymerase still attaches at the 3’ end and works down towards the 5’ end, but this is directly next to the replication form. Therefore, every time the replication fork unwinds further, the enzyme has to reattach to the 3’ end, and this creates small fragments of DNA. This strand is called the ‘lagging strand’ and the small fragments are called Okazaki fragments. The Okazaki fragments are later joined together by the enzyme DNA ligase.

Nucleotides and Nucleic Acids, figure 3

Both DNA template strands are now replicated and this process continues until the entire length of DNA is replication.

Nucleotides and Nucleic Acids, figure 4

Semi Conservative Replication

DNA replication is described as semi-conservative because in replication one strand is conserved and one new strand is created.

Nucleotides and Nucleic Acids, figure 1

Meselson and Stahl performed the experiment below to prove this.

Nucleotides and Nucleic Acids, figure 2

Bacteria were grown in a solution containing the 15N isotope. This is a heavier form of nitrogen. During replication, all the new DNA molecules incorporated will contain this isotope in the nitrogenous base. The DNA is therefore heavier, and this is demonstrated by centrifuging and seeing the DNA band settling at a lower point in the test-tube.

A sample of this bacteria is then transferred to a solution containing only the 14N lighter isotope of nitrogen and left to replicate once only. All the DNA newly synthesised will now be lighter. After centrifugation all the DNA settles in the middle of the test-tube, which shows that in DNA replication 50% of the old DNA is always conserved and 50% of the DNA is new.

The bacteria are left to replicate for a second time in the light 14N medium. After another round of semi-conservative replication the results can be seen above. There will now be two double helices composed of completely light DNA and two double helices that contain one heavy strand and one light strand.

The Genetic Code

The genetic code has three special features; it is degenerate, universal and non-overlapping. At the start of every gene there is a ‘start codon’ TAC in DNA or AUG in mRNA. This codes for the amino acid methionine. This methionine is later removed from the protein if it is not actually needed for the structure. At the end of every gene there are 3 bases that do no code for an amino acid and is none as a ‘stop codon’. These stop codons mark the end of a polypeptide chain and as stop translation from occurring further. These codons are ATT, ATC and ACT on DNA.

Degenerate

There are 20 amino acids that the genetic code has to be able to code for. There are four DNA bases, (GCTA), and therefore three bases are needed to make enough combinations to code for at least 20 amino acids.

This can be proven mathematically:

  1. If one base coded for one amino acid this would only allow for 4 amino acids to be coded for. This is insufficient to code for 20 amino acids.
  2. If two bases coded for one amino acid this would allow for 16 amino acids to be coded for (4x4 combinations of code). This is insufficient to code for 20 amino acids.
  3. If three bases coded for one amino acid this would allow for 64 amino acids to be coded for (4 x 4 x 4 combinations of code).

64 combinations is more than is needed to code for 20 amino acids, and as a result each amino acid is actually coded for by more than one triplet of bases. This is what is meant by the genetic code be degenerate. e.g. tyrosine is coded for by ATA and ATG.

Nucleotides and Nucleic Acids, figure 1

This genetic code wheel enables you to work out all combinations of bases that code for each of the 20 amino acids (the amino acids are on the outside of wheel abbreviated to the first three letters of each one).

Universal

The same triplet of bases codes for the same amino acid in all organisms, this is why the genetic code is described as being universal.

Non-Overlapping

Each base in a gene is only part of one triplet of bases that codes for one amino acid. Therefore each codon, or triplet of bases, is read as a discrete unit.

Introns and Exons

Introns are sections of DNA that do not code for amino acids and therefore polypeptide chains. These get removed, spliced, out of mRNA molecules

Exons are the sections of DNA that do code for amino acids.

Nucleotides and Nucleic Acids, figure 2

If all the DNA were distributed equally between the chromosomes calculate the mean length of DNA in each one. (in meters)
Your answer should include: 0.05m / 0.05

Protein Synthesis

Proteins are created on the ribosomes.

The production of proteins from the DNA code within DNA occurs in two main stages:

  1. Transcription – where the DNA code for one gene is copied into mRNA.

  2. __Translation __– where the mRNA joins with a ribosome, and a corresponding tRNA molecules brings the specific amino acid the codon codes for.

Nucleotides and Nucleic Acids, figure 1

__mRNA __is a short, single stranded molecule that is found in both the cytoplasm and nucleus. It is made during transcription in the nucleus. It is copied from DNA and is therefore complementary to the DNA sequence. In mRNA, groups of three adjacent bases are called codons.

tRNA molecules are found in the cytoplasm and have amino acids attached to them. Each tRNA is specific to one amino acid, determined by the anticodon on it (three base). Each tRNA molecule has an anticodon which is complementary to the codons on mRNA. tRNA is involved in translation. It carries the amino acids that are used to make proteins to the ribosomes. tRNA is a single polynucleotide strand that’s folded into a clover shape. H bonds between base pairs hold the shape.

Transcription

This is the process in which a complementary mRNA copy of one gene on the DNA is created in the nucleus. mRNA is much smaller than DNA so it is able to carry the genetic code to the ribosome in the cytoplasm to enable the protein to be made.

Nucleotides and Nucleic Acids, figure 2

The DNA helix unwinds to expose the bases to act as a template. Only one chain of the DNA acts as a template, and this is the antisense strand. Like with DNA replication, this unwinding and unzipping is catalysesd by DNA helicase. DNA helicase breaks the hydrogen bonds between bases. Free mRNA nucleotides align opposite exposed complementary DNA bases. The enzyme RNA polymerase bonds together the RNA nucleotides to create a new RNA polymer chain. One entire gene is copied. Once copied, the mRNA is modified and then leaves the nucleus through the nuclear envelope pores.

Nucleotides and Nucleic Acids, figure 3

Nucleotides and Nucleic Acids, figure 4

###

Translation

This is the stage in which the polypeptide chain is created using both the mRNA base sequence and the tRNA.

Once the modified mRNA has left the nucleus is attaches to a ribosome in the cytoplasm. The ribosome attaches at the 3’ end of the mRNA at the start codon, AUG. The tRNA molecule with the complementary anticodon to the AUG codon aligns opposite the mRNA, held in place by the ribosome. The ribosome will move along the mRNA molecule to enable another complementary tRNA to attach to the next codon on the mRNA. The two amino acids that have been delivered by the tRNA molecule are then joined via a peptide bond which is catalysed by an enzyme. This continues to occur until the ribosome reaches the stop codon at the end of the mRNA molecule. The stop codon does not code for an amino acid and therefore the ribosome detaches and translation ends. The polypeptide chain is now created and will enter the Golgi body for folding and modification.

Nucleotides and Nucleic Acids, figure 5

Transcribe the following DNA code: TACGGCTTACGACCACGACCCAAATAGATT (Without spaces in your answer)
AUGCCGAAUGCUGGUGCUGGGUUUAUCUAA
Where does transcription take place?
Nucleus
What is made during transcription?
mRNA
What happens after transcription?
Translation